ZFIN ID: ZDB-MRPHLNO-200511-6
Morpholino Name: MO3-znf
Targets: znf996 (1), znf1042 (1), znf1047 (1), znf1083 (1), znf1114 (1), znf1119 (1), znf1128 (1), znf1140 (1)
Sequence:
5' - AGATCAGTCGCTTCAGCAGGAGTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 407 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-znf No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-znf No data available
PHENOTYPE
Phenotype resulting from MO3-znf
No data available

Phenotype of all Fish created by or utilizing MO3-znf
No data available
Genome Resources:
CITATIONS (1)