Morpholino

MO3-znf

ID
ZDB-MRPHLNO-200511-6
Name
MO3-znf
Previous Names
None
Targets
Sequence
5' - AGATCAGTCGCTTCAGCAGGAGTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 407 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-znf
No data available
Phenotype
Phenotype resulting from MO3-znf
No data available
Phenotype of all Fish created by or utilizing MO3-znf
No data available
Citations