Morpholino

MO1-cthrc1a

ID

ZDB-MRPHLNO-191101-1

Name

MO1-cthrc1a

Previous Names

None

Target

cthrc1a (1)

Sequence

5' - CAGTTAGTTTGGTCGCTCCTGCTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cthrc1a

No data available

Phenotype

Phenotype resulting from MO1-cthrc1a

Phenotype	Fish	Figures
blastoderm increased thickness, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019
blastoderm margin irregular spatial pattern, abnormal	AB + MO1-cthrc1a	Fig. 2 from Cheng et al., 2019
blastoderm cell decreased adhesivity, abnormal	AB + MO1-cthrc1a	Fig. S5 from Cheng et al., 2019
blastoderm segmentation delayed, abnormal	AB + MO1-cthrc1a	Fig. 1 , Fig. 2 from Cheng et al., 2019
cell migration involved in gastrulation disrupted, abnormal	AB + MO1-cthrc1a	Fig. 4, Fig. MovieS1 from Cheng et al., 2019
convergent extension involved in axis elongation disrupted, abnormal	AB + MO1-cthrc1a	Fig. 1 , Fig. 3 from Cheng et al., 2019
epiboly disrupted, abnormal	AB + MO1-cthrc1a	Fig. 1 , Fig. 2, Fig. S3 from Cheng et al., 2019
epiboly involved in gastrulation with mouth forming second delayed, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019
mesoderm migration involved in gastrulation disrupted, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019
neural plate increased width, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019
notochord increased width, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019
paraxial mesoderm condensed, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019
shield aplastic, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019
spinal cord axon regeneration decreased occurrence, abnormal	mps1Tg + MO1-cthrc1a	Fig. 6 from Tsata et al., 2020
swimming decreased occurrence, abnormal	mps1Tg + MO1-cthrc1a	Fig. 6 from Tsata et al., 2020
whole organism anterior-posterior axis curved, abnormal	AB + MO1-cthrc1a	Fig. 3 from Cheng et al., 2019
whole organism anterior-posterior axis decreased length, abnormal	AB + MO1-cthrc1a	Fig. 1 from Cheng et al., 2019

Phenotype of all Fish created by or utilizing MO1-cthrc1a

Phenotype	Fish	Conditions	Figures
mesoderm migration involved in gastrulation disrupted, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
neural plate increased width, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
whole organism anterior-posterior axis curved, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 3 from Cheng et al., 2019
notochord increased width, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
blastoderm cell decreased adhesivity, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. S5 from Cheng et al., 2019
whole organism anterior-posterior axis decreased length, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
epiboly disrupted, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 , Fig. 2, Fig. S3 from Cheng et al., 2019
blastoderm segmentation delayed, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 , Fig. 2 from Cheng et al., 2019
convergent extension involved in axis elongation disrupted, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 , Fig. 3 from Cheng et al., 2019
paraxial mesoderm condensed, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
shield aplastic, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
blastoderm margin irregular spatial pattern, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 2 from Cheng et al., 2019
epiboly involved in gastrulation with mouth forming second delayed, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
blastoderm increased thickness, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 1 from Cheng et al., 2019
cell migration involved in gastrulation disrupted, abnormal	AB + MO1-cthrc1a	standard conditions	Fig. 4, Fig. MovieS1 from Cheng et al., 2019
swimming decreased occurrence, abnormal	mps1Tg + MO1-cthrc1a	standard conditions	Fig. 6 from Tsata et al., 2020
spinal cord axon regeneration decreased occurrence, abnormal	mps1Tg + MO1-cthrc1a	standard conditions	Fig. 6 from Tsata et al., 2020

Citations