Morpholino

MO6-rbm24a

ID

ZDB-MRPHLNO-190827-1

Name

MO6-rbm24a

Previous Names

None

Target

Sequence

5' - GCATCCTCACGAAACGCTCAAGTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-rbm24a

Expressed Gene	Anatomy	Figures
sox2	whole organism	Fig. 7 from Dash et al., 2019

Phenotype

Phenotype resulting from MO6-rbm24a

Phenotype	Fish	Figures
embryonic camera-type eye morphogenesis decreased process quality, abnormal	WT + MO6-rbm24a	Fig. 3 from Dash et al., 2019
eye decreased size, abnormal	WT + MO6-rbm24a	Figure 2 from Brastrom et al., 2021 Fig. 4 , Fig. 7 from Brastrom et al., 2019 Fig. 3 from Dash et al., 2019
heart edematous, abnormal	WT + MO6-rbm24a	Figure 2 from Brastrom et al., 2021
lens nucleus increased amount, abnormal	WT + MO6-rbm24a	Fig. 7 from Brastrom et al., 2019
optomotor response disrupted, abnormal	WT + MO6-rbm24a	Fig. 4 from Brastrom et al., 2019
pericardium edematous, abnormal	WT + MO6-rbm24a	Fig. 4 from Brastrom et al., 2019
retina layer formation disrupted, abnormal	WT + MO6-rbm24a	Fig. 7 from Brastrom et al., 2019
startle response process quality, abnormal	WT + MO6-rbm24a	Figure 5 from Brastrom et al., 2021
visual behavior process quality, abnormal	WT + MO6-rbm24a	Figure 6 from Brastrom et al., 2021
whole organism sox2 expression decreased amount, abnormal	WT + MO6-rbm24a	Fig. 7 from Dash et al., 2019

Phenotype of all Fish created by or utilizing MO6-rbm24a

Phenotype	Fish	Conditions	Figures
embryonic camera-type eye morphogenesis decreased process quality, abnormal	WT + MO6-rbm24a	standard conditions	Fig. 3 from Dash et al., 2019
optomotor response disrupted, abnormal	WT + MO6-rbm24a	standard conditions	Fig. 4 from Brastrom et al., 2019
whole organism sox2 expression decreased amount, abnormal	WT + MO6-rbm24a	standard conditions	Fig. 7 from Dash et al., 2019
lens nucleus increased amount, abnormal	WT + MO6-rbm24a	standard conditions	Fig. 7 from Brastrom et al., 2019
heart edematous, abnormal	WT + MO6-rbm24a	standard conditions	Figure 2 from Brastrom et al., 2021
startle response process quality, abnormal	WT + MO6-rbm24a	standard conditions	Figure 5 from Brastrom et al., 2021
visual behavior process quality, abnormal	WT + MO6-rbm24a	standard conditions	Figure 6 from Brastrom et al., 2021
retina layer formation disrupted, abnormal	WT + MO6-rbm24a	standard conditions	Fig. 7 from Brastrom et al., 2019
pericardium edematous, abnormal	WT + MO6-rbm24a	standard conditions	Fig. 4 from Brastrom et al., 2019
eye decreased size, abnormal	WT + MO6-rbm24a	standard conditions	Figure 2 from Brastrom et al., 2021 Fig. 4 , Fig. 7 from Brastrom et al., 2019 Fig. 3 from Dash et al., 2019

Citations