Morpholino

MO1-tmem33

ID
ZDB-MRPHLNO-190716-4
Name
MO1-tmem33
Previous Names
  • tmem33 sp2b morpholino (1)
Target
Sequence
5' - AATTGCTAACACAGACATGACAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tmem33
No data available
Phenotype
Phenotype resulting from MO1-tmem33
No data available
Phenotype of all Fish created by or utilizing MO1-tmem33
Phenotype Fish Conditions Figures
dorsal aorta blood vessel endothelial cell notch1b expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel Notch signaling pathway decreased occurrence, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 4 with image from Savage et al., 2019
dorsal aorta Notch signaling pathway decreased occurrence, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell notch1b expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta blood vessel endothelial cell hey2 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell dll4 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta blood vessel endothelial cell her12 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell her12 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell Venus expression decreased amount, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta blood vessel endothelial cell Venus expression decreased amount, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel Notch signaling pathway decreased occurrence, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
spinal cord Venus expression decreased amount, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta Notch signaling pathway decreased occurrence, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal sh467Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell filopodium assembly decreased occurrence, abnormal sh467Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell has fewer parts of type endothelial tip cell filopodium, abnormal sh467Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell spade-shaped, abnormal y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
dorsal longitudinal anastomotic vessel split, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
dorsal longitudinal anastomotic vessel sprouting angiogenesis decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
cardiovascular system lacks all parts of type vascular lymphangioblast, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
lymph vessel development decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
cardiovascular system lacks all parts of type thoracic duct, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
dorsal longitudinal anastomotic vessel malformed, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
endothelial tip cell regulation of cytosolic calcium ion concentration decreased occurrence, abnormal ubs3Tg ; sh392Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
endothelial tip cell calcium-mediated signaling decreased occurrence, abnormal ubs3Tg ; sh392Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell GCaMP expression decreased amount, abnormal ubs3Tg ; sh392Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
endothelial tip cell regulation of store-operated calcium channel activity decreased occurrence, abnormal ubs3Tg ; sh392Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
Citations