Morpholino

MO1-lrp4

ID
ZDB-MRPHLNO-190604-1
Name
MO1-lrp4
Previous Names
  • sd MO (1)
Target
Sequence
5' - ATCAGTGTTGTTGATCTGACCTGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lrp4
Phenotype
Phenotype resulting from MO1-lrp4
Phenotype Fish Figures
embryonic viscerocranium morphogenesis process quality, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
fin fold pectoral fin bud proximal region lrp4 expression absent, abnormal li1Tg + MO1-lrp4 Fig. 2 from Tian et al., 2018
head skeletal element morphology, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
median fin fold blistered, abnormal li1Tg + MO1-lrp4 Fig. 2 from Tian et al., 2018
median fin fold degenerate, abnormal li1Tg + MO1-lrp4 Fig. 2 from Tian et al., 2018
median fin fold jag1b expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
median fin fold fras1 expression increased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
median fin fold anatomical margin irregularly shaped, abnormal li1Tg + MO1-lrp4 Fig. 2 from Tian et al., 2018
nephron morphology, abnormal li1Tg + MO1-lrp4 Fig. 3 from Tian et al., 2018
pectoral fin blistered, abnormal li1Tg + MO1-lrp4 Fig. 2 from Tian et al., 2018
pectoral fin dkk1b expression decreased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
pectoral fin jag1b expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
pectoral fin wnt5b expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
pectoral fin anatomical margin irregularly shaped, abnormal li1Tg + MO1-lrp4 Fig. 2 from Tian et al., 2018
proctodeum pax2a expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
pronephric duct pax2a expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
renal system morphology, abnormal li1Tg + MO1-lrp4 Fig. 3 from Tian et al., 2018
renal system development process quality, abnormal li1Tg + MO1-lrp4 Fig. 3 from Tian et al., 2018
retina lrp4 expression decreased amount, abnormal li1Tg + MO1-lrp4 Fig. 2 from Tian et al., 2018
whole organism pax2a expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism lhx1a expression decreased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism grip1 expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism wt1b expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism wt1a expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism dkk1b expression decreased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism furina expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism apc expression decreased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism nphs2 expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism nphs1 expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism hmcn2 expression decreased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism wnt5b expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism lrp6 expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism fzd2 expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism notch2 expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism her1 expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism her2 expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism itga3b expression increased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism jag2b expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism rspo1 expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism jag2a expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism frem2a expression increased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
whole organism tcf7 expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism jag1b expression increased amount, abnormal AB + MO1-lrp4 Fig. 5 from Tian et al., 2018
whole organism fras1 expression increased amount, abnormal AB + MO1-lrp4 Fig. 4 from Tian et al., 2018
Phenotype of all Fish created by or utilizing MO1-lrp4
Phenotype Fish Conditions Figures
whole organism tcf7 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
median fin fold jag1b expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
median fin fold fras1 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism her2 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
pectoral fin dkk1b expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism dkk1b expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
head skeletal element morphology, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism rspo1 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism her1 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
embryonic viscerocranium morphogenesis process quality, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism wnt5b expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism lrp6 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism pax2a expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism lhx1a expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism wt1a expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism notch2 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism furina expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism jag1b expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
pronephric duct pax2a expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism jag2a expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism grip1 expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
pectoral fin wnt5b expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism fras1 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism wt1b expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism hmcn2 expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism frem2a expression increased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism nphs2 expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism jag2b expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism apc expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
pectoral fin jag1b expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
whole organism itga3b expression increased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism nphs1 expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
whole organism fzd2 expression increased amount, abnormal AB + MO1-lrp4 control Fig. 5 from Tian et al., 2018
proctodeum pax2a expression decreased amount, abnormal AB + MO1-lrp4 control Fig. 4 from Tian et al., 2018
renal system development process quality, abnormal li1Tg + MO1-lrp4 control Fig. 3 from Tian et al., 2018
nephron morphology, abnormal li1Tg + MO1-lrp4 control Fig. 3 from Tian et al., 2018
median fin fold blistered, abnormal li1Tg + MO1-lrp4 control Fig. 2 from Tian et al., 2018
renal system morphology, abnormal li1Tg + MO1-lrp4 control Fig. 3 from Tian et al., 2018
retina lrp4 expression decreased amount, abnormal li1Tg + MO1-lrp4 control Fig. 2 from Tian et al., 2018
median fin fold degenerate, abnormal li1Tg + MO1-lrp4 control Fig. 2 from Tian et al., 2018
median fin fold anatomical margin irregularly shaped, abnormal li1Tg + MO1-lrp4 control Fig. 2 from Tian et al., 2018
fin fold pectoral fin bud proximal region lrp4 expression absent, abnormal li1Tg + MO1-lrp4 control Fig. 2 from Tian et al., 2018
pectoral fin anatomical margin irregularly shaped, abnormal li1Tg + MO1-lrp4 control Fig. 2 from Tian et al., 2018
pectoral fin blistered, abnormal li1Tg + MO1-lrp4 control Fig. 2 from Tian et al., 2018
Citations