Morpholino

MO1-dusp26

ID

ZDB-MRPHLNO-180105-2

Name

MO1-dusp26

Previous Names

Target

Sequence

5' - GAGACAATCTGGACATAAACGCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dusp26

Expressed Gene	Anatomy	Figures
dusp23b	whole organism	Fig. 6 from Yang et al., 2017

Phenotype

Phenotype resulting from MO1-dusp26

Phenotype	Fish	Figures
axonogenesis disrupted, abnormal	rw0Tg + MO1-dusp26	Fig. 7 from Yang et al., 2017
cranial motor neuron axon decreased length, abnormal	rw0Tg + MO1-dusp26	Fig. 7 from Yang et al., 2017
eye decreased size, abnormal	WT + MO1-dusp26	Fig. 6 from Yang et al., 2017
head decreased size, abnormal	WT + MO1-dusp26	Fig. 6 from Yang et al., 2017
lens immature, abnormal	WT + MO1-dusp26	Fig. 7 from Yang et al., 2017
retina layer formation disrupted, abnormal	WT + MO1-dusp26	Fig. 7 from Yang et al., 2017
whole organism Ab2-ntrk1 labeling increased amount, abnormal	WT + MO1-dusp26	Fig. 6 from Yang et al., 2017
whole organism Ab3-ntrk1 labeling increased amount, abnormal	WT + MO1-dusp26	Fig. 6 from Yang et al., 2017
whole organism Ab2-fgfr labeling increased amount, abnormal	WT + MO1-dusp26	Fig. 6 from Yang et al., 2017

Phenotype of all Fish created by or utilizing MO1-dusp26

Phenotype	Fish	Conditions	Figures
lens immature, abnormal	WT + MO1-dusp26	standard conditions	Fig. 7 from Yang et al., 2017
head decreased size, abnormal	WT + MO1-dusp26	standard conditions	Fig. 6 from Yang et al., 2017
whole organism Ab2-fgfr labeling increased amount, abnormal	WT + MO1-dusp26	standard conditions	Fig. 6 from Yang et al., 2017
retina layer formation disrupted, abnormal	WT + MO1-dusp26	standard conditions	Fig. 7 from Yang et al., 2017
whole organism Ab3-ntrk1 labeling increased amount, abnormal	WT + MO1-dusp26	standard conditions	Fig. 6 from Yang et al., 2017
whole organism Ab2-ntrk1 labeling increased amount, abnormal	WT + MO1-dusp26	standard conditions	Fig. 6 from Yang et al., 2017
eye decreased size, abnormal	WT + MO1-dusp26	standard conditions	Fig. 6 from Yang et al., 2017
axonogenesis disrupted, abnormal	rw0Tg + MO1-dusp26	standard conditions	Fig. 7 from Yang et al., 2017
cranial motor neuron axon decreased length, abnormal	rw0Tg + MO1-dusp26	standard conditions	Fig. 7 from Yang et al., 2017

Citations