ZFIN ID: ZDB-MRPHLNO-170922-1
Morpholino Name: MO1-abcb10
Target: abcb10 (1)
Previous Name: MO2-abcb10 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTTCACCATCCATACTTCACCTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: exon 2-intron 2 splice morpholino
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-abcb10 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-abcb10 No data available
PHENOTYPE
Phenotype resulting from MO1-abcb10
Phenotype of all Fish created by or utilizing MO1-abcb10
Genome Resources:
CITATIONS (1)