Morpholino

MO2-tpcn2

ID

ZDB-MRPHLNO-170630-2

Name

MO2-tpcn2

Previous Names

TPCN2-MO-S (1)

Target

tpcn2 (1)

Sequence

5' - TGATTGTGTTTTTACCTTAATCGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tpcn2

No data available

Phenotype

Phenotype resulting from MO2-tpcn2

Phenotype	Fish	Figures
myotome decreased width, abnormal	WT + MO2-tpcn2 + MO4-tp53	Fig. 3 , Fig. 4 from Kelu et al., 2017
slow muscle cell decreased amount, abnormal	WT + MO2-tpcn2 + MO4-tp53	Fig. 4 from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal	WT + MO2-tpcn2 + MO4-tp53	Fig. 3 from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal	WT + MO2-tpcn2 + MO4-tp53	Fig. 3 from Kelu et al., 2017
somite U-shaped, abnormal	WT + MO2-tpcn2 + MO4-tp53	Fig. 3 , Fig. 4 from Kelu et al., 2017
striated muscle cell decreased width, abnormal	WT + MO2-tpcn2 + MO4-tp53	Fig. 4 from Kelu et al., 2017
striated muscle cell increased length, abnormal	WT + MO2-tpcn2 + MO4-tp53	Fig. 4 from Kelu et al., 2017

Phenotype of all Fish created by or utilizing MO2-tpcn2

Phenotype	Fish	Conditions	Figures
slow muscle cell decreased amount, abnormal	WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 4 from Kelu et al., 2017
striated muscle cell decreased width, abnormal	WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 4 from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal	WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 from Kelu et al., 2017
myotome decreased width, abnormal	WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
striated muscle cell increased length, abnormal	WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 4 from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal	WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 from Kelu et al., 2017
somite U-shaped, abnormal	WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
slow muscle cell decreased amount, abnormal	WT + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 4 from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal	WT + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 from Kelu et al., 2017
striated muscle cell decreased width, abnormal	WT + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 4 from Kelu et al., 2017
myotome decreased width, abnormal	WT + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
striated muscle cell increased length, abnormal	WT + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 4 from Kelu et al., 2017
somite U-shaped, abnormal	WT + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal	WT + MO2-tpcn2 + MO4-tp53	standard conditions	Fig. 3 from Kelu et al., 2017

Citations