ZFIN ID: ZDB-MRPHLNO-170419-4
Morpholino Name: MO2-dab2ipa
Target: dab2ipa (1)
Sequence:
5' - GCTTTCCACTAACACCTTACCCAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-dab2ipa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-dab2ipa No data available
PHENOTYPE
Phenotype resulting from MO2-dab2ipa
No data available

Phenotype of all Fish created by or utilizing MO2-dab2ipa
No data available
OTHER MO2-dab2ipa MORPHOLINO PAGESNo links to external sites
CITATIONS (1)