ZFIN ID: ZDB-MRPHLNO-170330-8
Morpholino Name: MO1-acot13
Target: acot13 (1)
Sequence:
5' - CAAAACACAGAGAAGGACAAGTTCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-acot13 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-acot13 No data available
PHENOTYPE
Phenotype resulting from MO1-acot13
Phenotype of all Fish created by or utilizing MO1-acot13
Genome Resources:
CITATIONS (1)