header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170209-1
Morpholino Name: MO1-zdhhc13
Target: zdhhc13 (1)
Sequence:
5' - ATCCGTCTCCTTCTGACCAGTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-zdhhc13 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-zdhhc13
Expressed Gene Anatomy Figures
chrd Fig. 2 from Chen et al., 2014
dlx3b Fig. 2 from Chen et al., 2014
eve1 Fig. 2 from Chen et al., 2014
foxi1 Fig. 2 from Chen et al., 2014
gsc Fig. 2 from Chen et al., 2014
sox3 Fig. 2 from Chen et al., 2014
tbxta Fig. 2 from Chen et al., 2014
PHENOTYPE
Phenotype resulting from MO1-zdhhc13
Phenotype of all Fish created by or utilizing MO1-zdhhc13
Phenotype Fish Conditions Figures
whole organism eve1 expression decreased amount, abnormal AB + MO1-zdhhc13 control Fig. 2 from Chen et al., 2014
mesoderm dorsal region chrd expression increased distribution, abnormal AB + MO1-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
neuroectoderm sox3 expression increased distribution, abnormal AB + MO1-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
whole organism chrd expression increased amount, abnormal AB + MO1-zdhhc13 control Fig. 2 from Chen et al., 2014
heart decreased functionality, abnormal AB + MO1-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
presumptive ectoderm ventral region foxi1 expression decreased distribution, abnormal AB + MO1-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
whole organism tbxta expression decreased amount, abnormal AB + MO1-zdhhc13 control Fig. 2 from Chen et al., 2014
whole organism foxi1 expression decreased amount, abnormal AB + MO1-zdhhc13 control Fig. 2 from Chen et al., 2014
presumptive ventral mesoderm eve1 expression decreased distribution, abnormal AB + MO1-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
neuroectoderm dlx3b expression increased distribution, abnormal AB + MO1-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
somite distended, abnormal AB + MO1-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
ventral fin fold decreased thickness, abnormal AB + MO1-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
head increased size, abnormal AB + MO1-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
brain increased size, abnormal AB + MO1-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
whole organism sox3 expression increased amount, abnormal AB + MO1-zdhhc13 control Fig. 2 from Chen et al., 2014
OTHER MO1-zdhhc13 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)