header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160912-1
Morpholino Name: MO2-kctd10
Target: kctd10 (1)
Sequence:
5' - CACTTTCTCCTGACATCTCTTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-kctd10 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-kctd10
Expressed Gene Anatomy Figures
kdrl Fig. 8 from Hu et al., 2014
myh6 Fig. 7 from Hu et al., 2014
myh7 Fig. 7 from Hu et al., 2014
myl7 Fig. 7 from Hu et al., 2014
PHENOTYPE
Phenotype resulting from MO2-kctd10
Phenotype of all Fish created by or utilizing MO2-kctd10
OTHER MO2-kctd10 MORPHOLINO PAGES No links to external sites
CITATIONS (1)