header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160902-3
Morpholino Name: MO2-tgfbr3
Target: tgfbr3 (1)
Sequence:
5' - GAATAACAGCGCTTACCTGCAGAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tgfbr3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tgfbr3
Expressed Gene Anatomy Figures
tgfbr3 Fig. 5 with image from Kamaid et al., 2015
PHENOTYPE
Phenotype resulting from MO2-tgfbr3
Phenotype Figures
caudal fin curved, abnormal Fig. 4 with image from Kamaid et al., 2015
caudal vein plexus morphology, abnormal Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
intersegmental vessel decreased amount, abnormal Fig. 4 with image from Kamaid et al., 2015
intersegmental vessel decreased size, abnormal Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
intersegmental vessel sprouting angiogenesis process quality, abnormal Fig. 4 with image from Kamaid et al., 2015
notochord tgfbr3 expression absent, abnormal Fig. 5 with image from Kamaid et al., 2015
somite circular, abnormal Fig. 7 with image from Kamaid et al., 2015
somite shape, abnormal Fig. 7 with image from Kamaid et al., 2015
somite actin filament disorganized, abnormal Fig. 7 with image from Kamaid et al., 2015
somite ventral region tgfbr3 expression absent, abnormal Fig. 5 with image from Kamaid et al., 2015
somite border blurry, abnormal Fig. 7 with image from Kamaid et al., 2015
whole organism tgfbr3 expression absent, abnormal Fig. 5 with image from Kamaid et al., 2015
whole organism decreased size, abnormal Fig. 4 with image from Kamaid et al., 2015
whole organism shape, abnormal Fig. 4 with image from Kamaid et al., 2015

Phenotype of all Fish created by or utilizing MO2-tgfbr3
Phenotype Fish Conditions Figures
whole organism tgfbr3 expression absent, abnormal WT + MO2-tgfbr3 standard conditions Fig. 5 with image from Kamaid et al., 2015
somite ventral region tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 control Fig. 5 with image from Kamaid et al., 2015
somite circular, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
intersegmental vessel decreased amount, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
notochord tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 control Fig. 5 with image from Kamaid et al., 2015
caudal vein plexus morphology, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
somite actin filament disorganized, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
caudal fin curved, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
intersegmental vessel decreased size, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
whole organism shape, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
whole organism decreased size, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
somite shape, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
somite border blurry, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
OTHER MO2-tgfbr3 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)