Morpholino

MO1-adgra2

ID
ZDB-MRPHLNO-150904-2
Name
MO1-adgra2
Previous Names
None
Target
Sequence
5' - ACTGATATTGATTTAACTCACCACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adgra2
No data available
Phenotype
Phenotype resulting from MO1-adgra2
Phenotype of all Fish created by or utilizing MO1-adgra2
Phenotype Fish Conditions Figures
hindbrain brain vasculature decreased amount, abnormal WT + MO1-adgra2 control Fig. 4Fig. 5 from Eubelen et al., 2018
central artery decreased amount, abnormal WT + MO1-adgra2 control Fig. 4Fig. 5 from Eubelen et al., 2018
hindbrain central artery decreased amount, abnormal WT + MO1-adgra2 standard conditions Fig. 2 from Bostaille et al., 2017
central artery absent, abnormal s843Tg + MO1-adgra2 control Fig. 3 with image from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal s843Tg + MO1-adgra2 standard conditions Fig. 1 with image from Vanhollebeke et al., 2015
dorsal root ganglion decreased amount, abnormal w61Tg + MO1-adgra2 standard conditions Fig. 2 from Bostaille et al., 2017
hindbrain central artery absent, abnormal ia4Tg; s896Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal ia4Tg; s896Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal ia4Tg; s896Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
dorsal root ganglion Wnt signaling pathway decreased process quality, abnormal ia4Tg; vu234Tg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
basilar artery Wnt signaling pathway decreased process quality, abnormal ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-adgra2 standard conditions Fig. 3 with image from Vanhollebeke et al., 2015
dorsal root ganglion decreased amount, abnormal sb1Tg; vu234Tg + MO1-adgra2 control Fig. 3 with image from Vanhollebeke et al., 2015
Citations