header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150731-3
Morpholino Name: MO7-dmd
Target: dmd (1)
Sequence:
5' - GTCCGCCTCCTTAGACAGAGGAAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO7-dmd No data available
GENE EXPRESSION
Gene expression in Wild Types + MO7-dmd
Expressed Gene Anatomy Figures
dmd Fig. 2 with image from Rau et al., 2015
PHENOTYPE
Phenotype resulting from MO7-dmd
Phenotype of all Fish created by or utilizing MO7-dmd
Genome Resources:
CITATIONS (1)