ZFIN ID: ZDB-MRPHLNO-150302-2
Morpholino Name: MO1-ano6
Target: ano6 (1)
Previous Names: Intron 6/exon 7 (1), TMEM16F MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGCACTGTTGCACCACAAAAACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ano6 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ano6 No data available
PHENOTYPE
Phenotype resulting from MO1-ano6
Phenotype Figures
caudal fin posterior region malformed, abnormal Fig. 4 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal Fig. 4 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel malformed, abnormal Fig. 4 from Delcourt et al., 2015
eye decreased size, abnormal Fig. 4 from Delcourt et al., 2015
head decreased size, abnormal Fig. 4 from Delcourt et al., 2015
intersegmental vessel malformed, abnormal Fig. 4 from Delcourt et al., 2015
intersegmental vessel angiogenesis process quality, abnormal Fig. 4 from Delcourt et al., 2015
whole organism decreased length, abnormal Fig. 4 from Delcourt et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal Fig. 4 from Delcourt et al., 2015

Phenotype of all Fish created by or utilizing MO1-ano6
Phenotype Fish Conditions Figures
head decreased size, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
intersegmental vessel malformed, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel malformed, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
eye decreased size, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
whole organism decreased length, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
caudal fin posterior region malformed, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
intersegmental vessel angiogenesis process quality, abnormal zf565Tg + MO1-ano6 standard conditions Fig. 4 from Delcourt et al., 2015
OTHER MO1-ano6 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)