ZFIN ID: ZDB-MRPHLNO-150302-10
Morpholino Name: MO2-ano6
Target: ano6 (1)
Previous Name: TMEM16F MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTCATTGTCTTCAGTTTCACTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ano6 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ano6 No data available
PHENOTYPE
Phenotype resulting from MO2-ano6
Phenotype Figures
angiogenesis process quality, abnormal Fig. 3 from Delcourt et al., 2015
caudal fin posterior region curled, abnormal Fig. 3 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal Fig. 3 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel malformed, abnormal Fig. 3 from Delcourt et al., 2015
head decreased size, abnormal Fig. 3 from Delcourt et al., 2015
intersegmental vessel malformed, abnormal Fig. 3 from Delcourt et al., 2015
intersegmental vessel angiogenesis process quality, abnormal Fig. 3 from Delcourt et al., 2015

Phenotype of all Fish created by or utilizing MO2-ano6
Phenotype Fish Conditions Figures
dorsal longitudinal anastomotic vessel aplastic, abnormal zf565Tg + MO2-ano6 standard conditions Fig. 3 from Delcourt et al., 2015
intersegmental vessel angiogenesis process quality, abnormal zf565Tg + MO2-ano6 standard conditions Fig. 3 from Delcourt et al., 2015
head decreased size, abnormal zf565Tg + MO2-ano6 standard conditions Fig. 3 from Delcourt et al., 2015
angiogenesis process quality, abnormal zf565Tg + MO2-ano6 standard conditions Fig. 3 from Delcourt et al., 2015
caudal fin posterior region curled, abnormal zf565Tg + MO2-ano6 standard conditions Fig. 3 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel malformed, abnormal zf565Tg + MO2-ano6 standard conditions Fig. 3 from Delcourt et al., 2015
intersegmental vessel malformed, abnormal zf565Tg + MO2-ano6 standard conditions Fig. 3 from Delcourt et al., 2015
OTHER MO2-ano6 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)