ZFIN ID: ZDB-MRPHLNO-141117-24
Morpholino Name: MO1-mphosph8
Target: mphosph8 (1)
Sequence:
5' - TCAGCTACAAGTGTATTGTACCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mphosph8 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mphosph8 No data available
PHENOTYPE
Phenotype resulting from MO1-mphosph8
No data available

Phenotype of all Fish created by or utilizing MO1-mphosph8
No data available
Genome Resources:
CITATIONS (1)