Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-bcl2l16

ID
ZDB-MRPHLNO-140619-1
Name
MO1-bcl2l16
Previous Names
  • bclwav MO1 (1)
Target
Sequence
5' - CATCAGCTCAGATACACACAGGTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bcl2l16
No data available
Phenotype
Phenotype resulting from MO1-bcl2l16
Phenotype of all Fish created by or utilizing MO1-bcl2l16
Phenotype Fish Conditions Figures
actin polymerization or depolymerization process quality, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 5 from Prudent et al., 2013
pectoral fin morphology, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
mesodermal cell filamentous actin oriented, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 5 from Prudent et al., 2013
somite morphology, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
somite filamentous actin deformed, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
regulation of cytosolic calcium ion concentration disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 7 from Prudent et al., 2013
anterior/posterior axis specification disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
cell migration involved in gastrulation disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 4 from Prudent et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. S4 from Prudent et al., 2013
embryo development disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
mitochondrial calcium ion transmembrane transport disrupted, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 6 from Prudent et al., 2013
notochord bent, abnormal WT + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
notochord mislocalised laterally, abnormal t10Tg + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
notochord bent, abnormal t10Tg + MO1-bcl2l16 + MO4-tp53 standard conditions Fig. 3 from Prudent et al., 2013
Citations