header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140317-7
Morpholino Name: MO1-cspp1b
Target: cspp1b (1)
Previous Name: Cspp1b ex2i2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGCAAACAGAACTCTACCTTGCTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cspp1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cspp1b No data available
PHENOTYPE
Phenotype resulting from MO1-cspp1b
No data available

Phenotype of all Fish created by or utilizing MO1-cspp1b
Phenotype Fish Conditions Figures
brain hydrocephalic, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
neurocranial trabecula hypoplastic, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
fourth ventricle dilated, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
neurocranial trabecula aplastic, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
tectal ventricle dilated, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
proximal straight tubule cystic, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. S2 from Tuz et al., 2014
pharyngeal arch 3-7 decreased length, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
whole organism curved, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
ventricular system dilated, abnormal WT + MO1-cspp1a + MO1-cspp1b standard conditions Fig. 2 from Tuz et al., 2014
whole organism curved, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
fourth ventricle dilated, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
neurocranial trabecula hypoplastic, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
pharyngeal arch 3-7 decreased length, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
tectal ventricle dilated, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
proximal straight tubule cystic, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. S2 from Tuz et al., 2014
brain hydrocephalic, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
neurocranial trabecula aplastic, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
ventricular system dilated, abnormal WT + MO1-cspp1b + MO2-cspp1a standard conditions Fig. 2 from Tuz et al., 2014
Genome Resources:
CITATIONS (1)