ZFIN ID: ZDB-MRPHLNO-131108-7
Morpholino Name: MO2-hs3st1l2
Target: hs3st1l2 (1)
Previous Name: 3-OST-5 MO2, Intron 1/exon 2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGGCTTCTGAAACAGAAAGGAAATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-hs3st1l2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-hs3st1l2
Expressed Gene Anatomy Figures
spaw Fig. 1 with image from Neugebauer et al., 2013
PHENOTYPE
Phenotype resulting from MO2-hs3st1l2
Phenotype of all Fish created by or utilizing MO2-hs3st1l2
Genome Resources:
CITATIONS (1)