ZFIN ID: ZDB-MRPHLNO-131108-6
Morpholino Name: MO1-hs3st1l2
Target: hs3st1l2 (1)
Previous Name: 3-OST-5 MO1, Translational start site (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTCCAGTCAGGTCAAGGGCAGCTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hs3st1l2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hs3st1l2
Expressed Gene Anatomy Figures
dnah9 Fig. 3 with image from Neugebauer et al., 2013
foxa3 Fig. S1 with image from Neugebauer et al., 2013
foxj1a Fig. 3 with image from Neugebauer et al., 2013
il17rd Fig. 3 with image from Neugebauer et al., 2013
kif3b Fig. 5 with image from Neugebauer et al., 2013
lft1 Fig. S1 with image from Neugebauer et al., 2013
myl7 Fig. S1 with image from Neugebauer et al., 2013
rfx2 Fig. 3 with image from Neugebauer et al., 2013
shha Fig. S1 with image from Neugebauer et al., 2013
spaw Fig. 1 with image from Neugebauer et al., 2013
PHENOTYPE
Phenotype resulting from MO1-hs3st1l2
Phenotype of all Fish created by or utilizing MO1-hs3st1l2
Genome Resources:
CITATIONS (2)