ZFIN ID: ZDB-MRPHLNO-130614-1
Morpholino Name: MO6-dmd
Target: dmd (1)
Previous Name: dystrophin anti-sense 1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCATGACATAAGATCCAAGCCAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-dmd No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-dmd No data available
PHENOTYPE
Phenotype resulting from MO6-dmd
Phenotype of all Fish created by or utilizing MO6-dmd
Genome Resources:
CITATIONS (3)