ZFIN ID: ZDB-MRPHLNO-130321-2
Morpholino Name: MO4-rgs4
Target: rgs4 (1)
Previous Name: -22 to -47 5 prime of the start site (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCCAAAGCAAGAGAAAAGAAGTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-rgs4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-rgs4 No data available
PHENOTYPE
Phenotype resulting from MO4-rgs4
Phenotype of all Fish created by or utilizing MO4-rgs4
Genome Resources:
CITATIONS (1)