ZFIN ID: ZDB-MRPHLNO-130321-2
Morpholino Name: MO4-rgs4
Target: rgs4 (1)
Previous Name: -22 to -47 5 prime of the start site (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCCAAAGCAAGAGAAAAGAAGTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-rgs4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-rgs4 No data available
PHENOTYPE
Phenotype resulting from MO4-rgs4
Phenotype Figures
axon guidance disrupted, abnormal Fig. 5 from Cheng et al., 2013
cranial nerve V axon immature, abnormal Fig. S7 from Cheng et al., 2013
locomotory behavior decreased frequency, abnormal Fig. 3 from Cheng et al., 2013
Mauthner neuron axon morphology, abnormal Fig. 5 from Cheng et al., 2013
motor neuron axon truncated, abnormal Fig. 4 from Cheng et al., 2013
Rohon-Beard neuron axon decreased amount, abnormal Fig. 4 from Cheng et al., 2013
Rohon-Beard neuron axon truncated, abnormal Fig. 4 from Cheng et al., 2013
thigmotaxis process quality, abnormal Fig. 3 from Cheng et al., 2013

Phenotype of all Fish created by or utilizing MO4-rgs4
Phenotype Fish Conditions Figures
Rohon-Beard neuron axon truncated, abnormal TU + MO4-rgs4 standard conditions Fig. 4 from Cheng et al., 2013
Rohon-Beard neuron axon decreased amount, abnormal TU + MO4-rgs4 standard conditions Fig. 4 from Cheng et al., 2013
motor neuron axon truncated, abnormal TU + MO4-rgs4 standard conditions Fig. 4 from Cheng et al., 2013
thigmotaxis process quality, abnormal TU + MO4-rgs4 standard conditions Fig. 3 from Cheng et al., 2013
Mauthner neuron axon morphology, abnormal TU + MO4-rgs4 standard conditions Fig. 5 from Cheng et al., 2013
cranial nerve V axon immature, abnormal TU + MO4-rgs4 standard conditions Fig. S7 from Cheng et al., 2013
axon guidance disrupted, abnormal TU + MO4-rgs4 standard conditions Fig. 5 from Cheng et al., 2013
locomotory behavior decreased frequency, abnormal TU + MO4-rgs4 standard conditions Fig. 3 from Cheng et al., 2013
OTHER MO4-rgs4 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)