ZFIN ID: ZDB-MRPHLNO-130307-2
Morpholino Name: MO3-s1pr1
Target: s1pr1 (1)
Sequence:
5' - GTTTGCACTGGCTTGGTAGTTTTAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-s1pr1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-s1pr1 No data available
PHENOTYPE
Phenotype resulting from MO3-s1pr1
Phenotype of all Fish created by or utilizing MO3-s1pr1
Genome Resources:
CITATIONS (1)