Morpholino

MO2-wtip

ID
ZDB-MRPHLNO-130117-3
Name
MO2-wtip
Previous Names
None
Target
Sequence
5' - GATCCTCGTCGTATTCATCCATGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wtip
Expressed Gene Anatomy Figures
bmp4 Fig. 7 with image from Powell et al., 2016
evx1 Fig. 4 with image,  Fig. 5 with image from Bubenshchikova et al., 2012
lft1 Fig. 7 with image from Powell et al., 2016
myh6 Fig. 5 with image from Powell et al., 2016
myh7 Fig. 5 with image from Powell et al., 2016
myl7 Fig. 5 with image from Powell et al., 2016
nppa Fig. 5 with image from Powell et al., 2016
spaw Fig. 7 with image from Powell et al., 2016
tbx18 Fig. 2 with image,  Fig. 4 with image from Powell et al., 2016
tcf21 Fig. 2 with image,  Fig. 4 with image from Powell et al., 2016
wtip Fig. 1 with image from Powell et al., 2016
Phenotype
Phenotype resulting from MO2-wtip
Phenotype Fish Figures
atrial myocardium decreased thickness, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrial myocardium separated from ventricular myocardium, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrial myocardium separated from ventricular endocardium, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrioventricular canal nppa expression mislocalised, abnormal AB + MO2-wtip Fig. 5 with image from Powell et al., 2016
atrioventricular canal cell morphology, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
atrioventricular canal development decreased process quality, abnormal AB + MO2-wtip Fig. 5 with image from Powell et al., 2016
atrioventricular valve development decreased occurrence, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
brain hydrocephalic, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
ciliated cell ciliary rootlet absent, abnormal AB + MO2-wtip Fig. 4 with image from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO2-wtip Fig. 6 with image from Bubenshchikova et al., 2012
cloacal chamber malformed, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
cloacal chamber ciliated cell decreased amount, abnormal AB + MO2-wtip Fig. 4 with image from Bubenshchikova et al., 2012
determination of heart left/right asymmetry decreased occurrence, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
endocardial cushion absent, abnormal AB + MO2-wtip Fig. 6 with image from Powell et al., 2016
establishment of mitotic spindle orientation disrupted, abnormal AB + MO2-wtip Fig. 6 with image from Bubenshchikova et al., 2012
heart looping decreased occurrence, abnormal AB + MO2-wtip Fig. 5 with image from Powell et al., 2016
heart rudiment right side bmp4 expression mislocalised, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
lateral plate mesoderm right side lft1 expression mislocalised, abnormal AB + MO2-wtip Fig. 7 with image from Powell et al., 2016
pericardium edematous, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
proepicardial cluster tcf21 expression decreased amount, abnormal AB + MO2-wtip Fig. 2 with image,  Fig. 4 with image from Powell et al., 2016
proepicardial cluster tbx18 expression decreased amount, abnormal AB + MO2-wtip Fig. 2 with image,  Fig. 4 with image from Powell et al., 2016
proepicardial cluster ciliary basal body wtip expression absent, abnormal AB + MO2-wtip Fig. 1 with image from Powell et al., 2016
pronephric glomerulus cystic, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
pronephros cystic, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
pronephros anterior region dilated, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
pronephros ciliated cell decreased amount, abnormal AB + MO2-wtip Fig. 4 with image from Bubenshchikova et al., 2012
pronephros motile cilium immobile, abnormal AB + MO2-wtip Fig. SMovie 2 from Bubenshchikova et al., 2012
trunk curved, abnormal AB + MO2-wtip Fig. 2 with image from Bubenshchikova et al., 2012
Phenotype of all Fish created by or utilizing MO2-wtip
Phenotype Fish Conditions Figures
cloacal chamber malformed, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
endocardial cushion absent, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
ciliated cell ciliary rootlet absent, abnormal AB + MO2-wtip standard conditions Fig. 4 with image from Bubenshchikova et al., 2012
atrioventricular valve development decreased occurrence, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
atrioventricular canal nppa expression mislocalised, abnormal AB + MO2-wtip control Fig. 5 with image from Powell et al., 2016
pronephric glomerulus cystic, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
pronephros anterior region dilated, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
lateral plate mesoderm right side lft1 expression mislocalised, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
trunk curved, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
proepicardial cluster tbx18 expression decreased amount, abnormal AB + MO2-wtip control Fig. 2 with image,  Fig. 4 with image from Powell et al., 2016
brain hydrocephalic, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
heart looping decreased occurrence, abnormal AB + MO2-wtip control Fig. 5 with image from Powell et al., 2016
atrial myocardium separated from ventricular myocardium, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
atrioventricular canal cell morphology, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
pronephros motile cilium immobile, abnormal AB + MO2-wtip standard conditions Fig. SMovie 2 from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO2-wtip standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
determination of heart left/right asymmetry decreased occurrence, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
heart rudiment right side bmp4 expression mislocalised, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
pericardium edematous, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
atrioventricular canal development decreased process quality, abnormal AB + MO2-wtip control Fig. 5 with image from Powell et al., 2016
proepicardial cluster ciliary basal body wtip expression absent, abnormal AB + MO2-wtip control Fig. 1 with image from Powell et al., 2016
atrial myocardium separated from ventricular endocardium, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
cloacal chamber ciliated cell decreased amount, abnormal AB + MO2-wtip standard conditions Fig. 4 with image from Bubenshchikova et al., 2012
pronephros ciliated cell decreased amount, abnormal AB + MO2-wtip standard conditions Fig. 4 with image from Bubenshchikova et al., 2012
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO2-wtip control Fig. 7 with image from Powell et al., 2016
proepicardial cluster tcf21 expression decreased amount, abnormal AB + MO2-wtip control Fig. 2 with image,  Fig. 4 with image from Powell et al., 2016
atrial myocardium decreased thickness, abnormal AB + MO2-wtip control Fig. 6 with image from Powell et al., 2016
establishment of mitotic spindle orientation disrupted, abnormal AB + MO2-wtip standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
pronephros cystic, abnormal AB + MO2-wtip standard conditions Fig. 2 with image from Bubenshchikova et al., 2012
heart looping decreased occurrence, abnormal f1Tg + MO2-wtip control Fig. 5 with image from Powell et al., 2016
pronephros ciliated cell decreased amount, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
establishment of mitotic spindle orientation disrupted, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
ciliated cell cilium decreased length, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
cloacal chamber ciliated cell decreased amount, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
proepicardial cluster tbx18 expression absent, abnormal AB + MO2-wtip + MO4-wt1a control Fig. 4 with image from Powell et al., 2016
proepicardial cluster tcf21 expression absent, abnormal AB + MO2-wtip + MO4-wt1a control Fig. 4 with image from Powell et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.