ZFIN ID: ZDB-MRPHLNO-121207-9
Morpholino Name: MO2-hirip3
Target: hirip3 (1)
Sequence:
5' - CTTTTCAGTCACTTGTTTACCTGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-hirip3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-hirip3 No data available
PHENOTYPE
Phenotype resulting from MO2-hirip3
No data available

Phenotype of all Fish created by or utilizing MO2-hirip3
No data available
OTHER MO2-hirip3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)