ZFIN ID: ZDB-MRPHLNO-121207-8
Morpholino Name: MO1-hirip3
Target: hirip3 (1)
Sequence:
5' - TTATCGCGTCCTTTTCTTTGGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hirip3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hirip3 No data available
PHENOTYPE
Phenotype resulting from MO1-hirip3
Phenotype Figures
brain morphology, abnormal Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal Fig. S3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal Fig. 3 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal Fig. 3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal Fig. 3 with image from Blaker-Lee et al., 2012
ventricular system decreased size, abnormal Fig. 2 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal Fig. 3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal Fig. 3 with image from Blaker-Lee et al., 2012

Phenotype of all Fish created by or utilizing MO1-hirip3
Phenotype Fish Conditions Figures
post-vent region shape, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
brain morphology, abnormal WT + MO1-hirip3 standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO1-hirip3 standard conditions Fig. S3 with image from Blaker-Lee et al., 2012
whole organism pigmented, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
whole organism movement quality, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
ventricular system decreased size, abnormal WT + MO1-hirip3 standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-hirip3 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
skeletal muscle cell morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-fam57ba + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-fam57ba + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-fam57ba + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-asphd1 + MO1-hirip3 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve VII shape, abnormal rw0Tg + MO1-fam57ba + MO1-hirip3 + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-fam57ba + MO1-hirip3 + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
cranial nerve V decreased size, abnormal rw0Tg + MO1-fam57ba + MO1-hirip3 + MO4-tp53 standard conditions Fig. S3 with image from McCammon et al., 2017
OTHER MO1-hirip3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)