Morpholino

MO1-ttc26

ID
ZDB-MRPHLNO-120906-3
Name
MO1-ttc26
Previous Names
  • MO-AUG (1)
Target
Sequence
5' - CTGGCTTCATCCGAGACAAGAGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ttc26
No data available
Phenotype
Phenotype resulting from MO1-ttc26
Phenotype Fish Figures
cilium movement increased rate, abnormal AB + MO1-ttc26 Fig. S2 from Zhang et al., 2012
heart looping process quality, abnormal f1Tg + MO1-ttc26 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium decreased amount, abnormal TL + MO1-ttc26 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-ttc26 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement decreased frequency, abnormal TL + MO1-ttc26 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement process quality, abnormal TL + MO1-ttc26 Fig. 2 with image from Ishikawa et al., 2014
photoreceptor outer segment layer disorganized, abnormal AB + MO1-ttc26 Fig. 3 from Zhang et al., 2012
photoreceptor outer segment layer shortened, abnormal AB + MO1-ttc26 Fig. 3 from Zhang et al., 2012
post-vent region kinked, abnormal AB + MO1-ttc26 Fig. 3 from Zhang et al., 2012
pronephric duct increased size, abnormal AB + MO1-ttc26 Fig. 4 from Zhang et al., 2012
pronephric duct cilium decreased length, abnormal TL + MO1-ttc26 Fig. 2 with image from Ishikawa et al., 2014
pronephric tubule dilated, abnormal AB + MO1-ttc26 Fig. 4 from Zhang et al., 2012
pronephric tubule distended, abnormal AB + MO1-ttc26 Fig. 4 from Zhang et al., 2012
pronephros cilium disorganized, abnormal AB + MO1-ttc26 Fig. 4 from Zhang et al., 2012
pronephros cilium disoriented, abnormal AB + MO1-ttc26 Fig. 4 from Zhang et al., 2012
pronephros cilium shortened, abnormal AB + MO1-ttc26 Fig. 4 from Zhang et al., 2012
regulation of cilium beat frequency disrupted, abnormal AB + MO1-ttc26 Fig. 5Fig. S2 from Zhang et al., 2012
whole organism curved, abnormal AB + MO1-ttc26 Fig. 3 from Zhang et al., 2012
whole organism decreased length, abnormal AB + MO1-ttc26 Fig. 3 from Zhang et al., 2012
Phenotype of all Fish created by or utilizing MO1-ttc26
Phenotype Fish Conditions Figures
pronephric duct increased size, abnormal AB + MO1-ttc26 standard conditions Fig. 4 from Zhang et al., 2012
pronephric tubule dilated, abnormal AB + MO1-ttc26 standard conditions Fig. 4 from Zhang et al., 2012
whole organism decreased length, abnormal AB + MO1-ttc26 standard conditions Fig. 3 from Zhang et al., 2012
pronephros cilium shortened, abnormal AB + MO1-ttc26 standard conditions Fig. 4 from Zhang et al., 2012
cilium movement increased rate, abnormal AB + MO1-ttc26 standard conditions Fig. S2 from Zhang et al., 2012
regulation of cilium beat frequency disrupted, abnormal AB + MO1-ttc26 standard conditions Fig. 5Fig. S2 from Zhang et al., 2012
pronephros cilium disoriented, abnormal AB + MO1-ttc26 standard conditions Fig. 4 from Zhang et al., 2012
whole organism curved, abnormal AB + MO1-ttc26 standard conditions Fig. 3 from Zhang et al., 2012
photoreceptor outer segment layer disorganized, abnormal AB + MO1-ttc26 standard conditions Fig. 3 from Zhang et al., 2012
pronephric tubule distended, abnormal AB + MO1-ttc26 standard conditions Fig. 4 from Zhang et al., 2012
post-vent region kinked, abnormal AB + MO1-ttc26 standard conditions Fig. 3 from Zhang et al., 2012
photoreceptor outer segment layer shortened, abnormal AB + MO1-ttc26 standard conditions Fig. 3 from Zhang et al., 2012
pronephros cilium disorganized, abnormal AB + MO1-ttc26 standard conditions Fig. 4 from Zhang et al., 2012
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-ttc26 control Fig. 2 with image from Ishikawa et al., 2014
pronephric duct cilium decreased length, abnormal TL + MO1-ttc26 control Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement decreased frequency, abnormal TL + MO1-ttc26 control Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium decreased amount, abnormal TL + MO1-ttc26 control Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement process quality, abnormal TL + MO1-ttc26 control Fig. 2 with image from Ishikawa et al., 2014
heart looping process quality, abnormal f1Tg + MO1-ttc26 control Fig. 2 with image from Ishikawa et al., 2014
Citations