header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120716-1
Morpholino Name: MO1-hsf4
Target: hsf4 (1)
Sequence:
5' - CTGGGTTCTCCTGCATGACTGCACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hsf4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hsf4
Expressed Gene Anatomy Figures
dnase2b Fig. 6 from Cui et al., 2013
h2ax Fig. 6 from Cui et al., 2012
hsf4 Fig. 6 from Cui et al., 2013
rad51 Fig. 6 from Cui et al., 2012
PHENOTYPE
Phenotype resulting from MO1-hsf4
Phenotype of all Fish created by or utilizing MO1-hsf4
Genome Resources:
CITATIONS (2)