ZFIN ID: ZDB-MRPHLNO-120517-14
Morpholino Name: MO1-aldh18a1
Target: aldh18a1 (1)
Sequence:
5' - GAGAGACATGGTGATCTGATCTTAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-aldh18a1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-aldh18a1
Expressed Gene Anatomy Figures
gata1a Table 3 from Ma et al., 2010
hbae1.1 Table 3 from Ma et al., 2010
lcp1 Table 3 from Ma et al., 2010
spi1b Table 3 from Ma et al., 2010
tal1 Table 3 from Ma et al., 2010
PHENOTYPE
Phenotype resulting from MO1-aldh18a1
No data available

Phenotype of all Fish created by or utilizing MO1-aldh18a1
No data available
OTHER MO1-aldh18a1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)