Morpholino

MO2-dnaaf3

ID
ZDB-MRPHLNO-120406-5
Name
MO2-dnaaf3
Previous Names
  • dnaaf3 ex8 MO (1)
Target
Sequence
5' - TTCTGTGGATTGACAGCAGGAACTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dnaaf3
No data available
Phenotype
Phenotype resulting from MO2-dnaaf3
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
ciliated cell inner dynein arm decreased amount, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
ciliated cell outer dynein arm decreased amount, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
heart looping absent, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
left/right pattern formation disrupted, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
olfactory placode cilium immobile, abnormal WT + MO2-dnaaf3 Fig. Vid S4 from Mitchison et al., 2012
olfactory placode cilium structure, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
otolith amount, abnormal WT + MO2-dnaaf3 Fig. 5,  Fig. S5 from Mitchison et al., 2012
otolith malformed, abnormal WT + MO2-dnaaf3 Fig. 5,  Fig. S5 from Mitchison et al., 2012
post-vent region curled, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
pronephros cystic, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
spinal cord cilium decreased mobility, abnormal WT + MO2-dnaaf3 Fig. Vid S6 from Mitchison et al., 2012
whole organism anterior-posterior axis curved, abnormal WT + MO2-dnaaf3 Fig. 5 from Mitchison et al., 2012
Phenotype of all Fish created by or utilizing MO2-dnaaf3
Phenotype Fish Conditions Figures
left/right pattern formation disrupted, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
otolith amount, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5,  Fig. S5 from Mitchison et al., 2012
spinal cord cilium decreased mobility, abnormal WT + MO2-dnaaf3 standard conditions Fig. Vid S6 from Mitchison et al., 2012
olfactory placode cilium structure, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
brain hydrocephalic, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
heart looping absent, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
post-vent region curled, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
whole organism anterior-posterior axis curved, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
ciliated cell outer dynein arm decreased amount, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
pronephros cystic, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
ciliated cell inner dynein arm decreased amount, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5 from Mitchison et al., 2012
otolith malformed, abnormal WT + MO2-dnaaf3 standard conditions Fig. 5,  Fig. S5 from Mitchison et al., 2012
olfactory placode cilium immobile, abnormal WT + MO2-dnaaf3 standard conditions Fig. Vid S4 from Mitchison et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.