ZFIN ID: ZDB-MRPHLNO-120216-8
Morpholino Name: MO2-sncb
Target: sncb (1)
Previous Name: sncb E3/I3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGCAGAATCACCTTACCTGTTGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sncb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sncb No data available
PHENOTYPE
Phenotype resulting from MO2-sncb
No data available

Phenotype of all Fish created by or utilizing MO2-sncb
Phenotype Fish Conditions Figures
larval locomotory behavior decreased occurrence, abnormal AB + MO1-sncb + MO2-sncb standard conditions Fig. 6 from Milanese et al., 2012
dopaminergic neuron differentiation delayed, abnormal AB + MO1-sncb + MO1-sncgb + MO2-sncb + MO2-sncgb standard conditions Fig. 7 from Milanese et al., 2012
dopaminergic neuron decreased amount, abnormal AB + MO1-sncb + MO1-sncgb + MO2-sncb + MO2-sncgb standard conditions Fig. 7 from Milanese et al., 2012
larval locomotory behavior decreased occurrence, abnormal AB + MO1-sncb + MO1-sncgb + MO2-sncb + MO2-sncgb standard conditions Fig. 6 from Milanese et al., 2012
OTHER MO2-sncb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)