header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120203-1
Morpholino Name: MO1-fzd10
Target: fzd10 (1)
Sequence:
5' - TGAGTCCGACACCGGCAGCAAACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fzd10 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fzd10
Expressed Gene Anatomy Figures
axin2 Fig. 1 with image from Caron et al., 2012
dnah9 Fig. 3 with image from Caron et al., 2012
foxj1a Fig. 3 with imageFig. 4 with image from Caron et al., 2012
fzd10 Fig. 1 with image from Caron et al., 2012
sp5l Fig. 1 with image from Caron et al., 2012
spaw Fig. 1 with image from Caron et al., 2012
PHENOTYPE
Phenotype resulting from MO1-fzd10
Phenotype of all Fish created by or utilizing MO1-fzd10
Genome Resources:
CITATIONS (3)