header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120127-6
Morpholino Name: MO1-camk1db
Target: camk1db (1)
Previous Name: AS-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTGCCTCCGAATAACCTTCTTAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-camk1db No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-camk1db
Expressed Gene Anatomy Figures
emx1 Fig. 7 from Senga et al., 2012
en2a Fig. 7 from Senga et al., 2012
rx1 Fig. 7 from Senga et al., 2012
PHENOTYPE
Phenotype resulting from MO1-camk1db
Phenotype of all Fish created by or utilizing MO1-camk1db
Genome Resources:
CITATIONS (1)