ZFIN ID: ZDB-MRPHLNO-120111-1
Morpholino Name: MO1-rbm24a
Target: rbm24a (1)
Sequence:
5' - TGCATCCTCACGAAACGCTCAAGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rbm24a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rbm24a
Expressed Gene Anatomy Figures
dlc Fig. 3 with image from Maragh et al., 2014
dld Fig. 3 with image from Maragh et al., 2014
her1 Fig. 3 with image from Maragh et al., 2014
her7 Fig. 3 with image from Maragh et al., 2014
myh6 Fig. 4 with image from Maragh et al., 2011
myh7 Fig. 4 with image from Maragh et al., 2011
myl7 Fig. 4 with image from Maragh et al., 2011
myod1 Fig. 2 with imageFig. S1 with image from Maragh et al., 2014
notch1a Fig. S2 with image from Maragh et al., 2014
notch3 Fig. S2 with image from Maragh et al., 2014
tbx16 Fig. 3 with image from Maragh et al., 2014
PHENOTYPE
Phenotype resulting from MO1-rbm24a
Phenotype Figures
angiogenesis disrupted, abnormal Fig. 5 with image from Maragh et al., 2011
blood circulation decreased rate, abnormal Fig. 2 with image from Maragh et al., 2011
caudal vein absent, abnormal Fig. 5 with image from Maragh et al., 2011
chondrocranium cartilage aplastic, abnormal Fig. S1 with image from Maragh et al., 2014
dorsal aorta absent, abnormal Fig. 5 with image from Maragh et al., 2011
ethmoid cartilage absent, abnormal Fig. S1 with image from Maragh et al., 2014
eye decreased size, abnormal Fig. S1 with image from Maragh et al., 2014
head decreased size, abnormal Fig. S1 with image from Maragh et al., 2014
head muscle malformed, abnormal Fig. S1 with image from Maragh et al., 2014
heart edematous, abnormal Fig. 2 with imageFig. 5 with imageFig. 6 with image from Maragh et al., 2011
heart contraction decreased rate, abnormal Fig. 4 with image from Maragh et al., 2011
heart looping disrupted, abnormal Fig. 2 with imageFig. 5 with image from Maragh et al., 2011
hyosymplectic cartilage absent, abnormal Fig. S1 with image from Maragh et al., 2014
Meckel's cartilage absent, abnormal Fig. S1 with image from Maragh et al., 2014
mRNA processing process quality, abnormal Fig. 4 with image from Maragh et al., 2014
palatoquadrate cartilage absent, abnormal Fig. S1 with image from Maragh et al., 2014
posterior cardinal vein increased thickness, abnormal Fig. 5 with image from Maragh et al., 2011
skeletal muscle cell disorganized, abnormal Fig. 2 with image from Maragh et al., 2014
skeletal muscle cell loose, abnormal Fig. 2 with image from Maragh et al., 2014
somite decreased amount, abnormal Fig. 2 with image from Maragh et al., 2014
somite malformed, abnormal Fig. 2 with image from Maragh et al., 2014
somite morphology, abnormal Fig. 2 with image from Maragh et al., 2014
somite shape, abnormal Fig. 2 with image from Maragh et al., 2014
somite spatial pattern, abnormal Fig. 2 with image from Maragh et al., 2014
trunk vasculature disorganized, abnormal Fig. 5 with image from Maragh et al., 2011
trunk vasculature hypoplastic, abnormal Fig. 5 with image from Maragh et al., 2011

Phenotype of all Fish created by or utilizing MO1-rbm24a
Phenotype Fish Conditions Figures
heart contraction decreased rate, abnormal AB + MO1-rbm24a standard conditions Fig. 4 with image from Maragh et al., 2011
heart edematous, abnormal AB + MO1-rbm24a standard conditions Fig. 6 with image from Maragh et al., 2011
chondrocranium cartilage aplastic, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
heart edematous, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
skeletal muscle cell disorganized, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
head muscle malformed, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
palatoquadrate cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
mRNA processing process quality, abnormal WT + MO1-rbm24a standard conditions Fig. 4 with image from Maragh et al., 2014
head decreased size, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
somite shape, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite malformed, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite morphology, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
eye decreased size, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
heart looping disrupted, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
hyosymplectic cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
somite decreased amount, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
blood circulation decreased rate, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
skeletal muscle cell loose, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite spatial pattern, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
dorsal aorta absent, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
posterior cardinal vein increased thickness, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
heart looping disrupted, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
caudal vein absent, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
trunk vasculature disorganized, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
trunk vasculature hypoplastic, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
heart edematous, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
angiogenesis disrupted, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
blood circulation disrupted, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart tube unstructured, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart edematous, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart deformed, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
Genome Resources:
CITATIONS (2)