ZFIN ID: ZDB-MRPHLNO-110810-2
Morpholino Name: MO2-npc1
Target: npc1 (1)
Sequence:
5' - GAGTCCACCTGTACAACATTTACAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-npc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-npc1 No data available
PHENOTYPE 
Phenotype resulting from MO2-npc1
Phenotype Figures
epiboly involved in gastrulation with mouth forming second delayed, abnormal Fig. 5 from Schwend et al., 2011

Phenotype of all Fish created by or utilizing MO2-npc1
Phenotype Fish Conditions Figures
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO2-npc1 standard conditions Fig. 5 from Schwend et al., 2011
OTHER MO2-npc1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)