Morpholino

MO2-mir218

ID
ZDB-MRPHLNO-110628-5
Name
MO2-mir218
Previous Names
  • miR-218 MO2 (1)
Targets
Sequence
5' - CACATGGTTAGATCAAGCACAAGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino is designed with "wobble" so that it can target all three copies of mir218 (mir218a-1, mir218a-2, and mir218b).
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mir218
No data available
Phenotype
Phenotype resulting from MO2-mir218
No data available
Phenotype of all Fish created by or utilizing MO2-mir218
No data available
Citations