header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110321-2
Morpholino Name: MO1-wnt9a
Target: wnt9a (1)
Previous Name: wnt9a MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCAGGAGAAGGTGTCCATCCAGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-wnt9a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-wnt9a
Expressed Gene Anatomy Figures
col2a1a Fig. 7 with image from Curtin et al., 2011
dlx2a Fig. 6 with image from Kamel et al., 2013
Fig. 6 with image from Curtin et al., 2011
edn1 Fig. 6 with image from Kamel et al., 2013
ednraa Fig. 6 with image from Kamel et al., 2013
fgf3 Fig. 1 with image from Wu et al., 2015
foxd3 Fig. 6 with image from Kamel et al., 2013
gsc Fig. 6 with image from Curtin et al., 2011
nkx3-2 Fig. 6 with image from Kamel et al., 2013
shha Fig. 7 with image from Curtin et al., 2011
sox9a Fig. 6 with image from Kamel et al., 2013
Fig. 7 with image from Curtin et al., 2011
sox10 Fig. 6 with image from Kamel et al., 2013
Fig. 6 with image from Curtin et al., 2011
PHENOTYPE
Phenotype resulting from MO1-wnt9a
Phenotype Figures
cranial neural crest cell lateralized, abnormal Fig. 7 with image from Curtin et al., 2011
cranial neural crest cell dorsal region mislocalised laterally, abnormal Fig. 5 with image from Curtin et al., 2011
embryonic neurocranium morphogenesis decreased process quality, abnormal Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage aplastic, abnormal Fig. 3 with imageFig. 5 with imageFig. 7 with image from Curtin et al., 2011
ethmoid cartilage decreased length, abnormal Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage has fewer parts of type chondrocyte, abnormal Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte disorganized, abnormal Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte shape, abnormal Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte proliferation decreased occurrence, abnormal Fig. 2 with image from Dougherty et al., 2013
head hypoplastic, abnormal Fig. 3 with image from Curtin et al., 2011
neural crest cell development disrupted, abnormal Fig. 5 with imageFig. 7 with image from Curtin et al., 2011
neural crest cell migration disrupted, abnormal Fig. 5 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte circular, abnormal Fig. 3 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte disorganized, abnormal Fig. 3 with image from Curtin et al., 2011
neurocranial trabecula proximal region decreased length, abnormal Fig. 3 with imageFig. 5 with image from Curtin et al., 2011
neurocranial trabecula proximal region truncated, abnormal Fig. 7 with image from Curtin et al., 2011
parachordal cartilage postero-lateral region aplastic, abnormal Fig. 3 with image from Curtin et al., 2011
pharyngeal arch 1 mesenchyme nkx3-2 expression decreased amount, abnormal Fig. 6 with image from Kamel et al., 2013
pharyngeal arch 3-7 morphology, abnormal Fig. 7 with image from Curtin et al., 2011
stomodeum shape, abnormal Fig. 7 with image from Curtin et al., 2011
trabecula communis aplastic, abnormal Fig. 5 with image from Curtin et al., 2011
ventral mandibular arch aplastic, abnormal Fig. 3 with image from Curtin et al., 2011
whole organism nkx3-2 expression decreased amount, abnormal Fig. 6 with image from Kamel et al., 2013

Phenotype of all Fish created by or utilizing MO1-wnt9a
Phenotype Fish Conditions Figures
neural crest cell development disrupted, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
head hypoplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
pharyngeal arch 3-7 morphology, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
neurocranial trabecula proximal region truncated, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
parachordal cartilage postero-lateral region aplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
ethmoid cartilage aplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with imageFig. 7 with image from Curtin et al., 2011
ventral mandibular arch aplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
stomodeum shape, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
neurocranial trabecula proximal region decreased length, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte disorganized, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
cranial neural crest cell lateralized, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte circular, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
whole organism nkx3-2 expression decreased amount, abnormal WT + MO1-wnt9a standard conditions Fig. 6 with image from Kamel et al., 2013
pharyngeal arch 1 mesenchyme nkx3-2 expression decreased amount, abnormal WT + MO1-wnt9a standard conditions Fig. 6 with image from Kamel et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte shape, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage has fewer parts of type chondrocyte, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte disorganized, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage decreased length, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage decreased length, abnormal vu234Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal vu234Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte proliferation decreased occurrence, abnormal vu234Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage aplastic, abnormal zf220Tg + MO1-wnt9a(TU) standard conditions Fig. 5 with image from Curtin et al., 2011
trabecula communis aplastic, abnormal zf220Tg + MO1-wnt9a(TU) standard conditions Fig. 5 with image from Curtin et al., 2011
cranial neural crest cell dorsal region mislocalised laterally, abnormal zf220Tg + MO1-wnt9a(TU) standard conditions Fig. 5 with image from Curtin et al., 2011
neurocranial trabecula proximal region decreased length, abnormal zf220Tg + MO1-wnt9a(TU) standard conditions Fig. 5 with image from Curtin et al., 2011
neural crest cell migration disrupted, abnormal zf220Tg + MO1-wnt9a(TU) standard conditions Fig. 5 with image from Curtin et al., 2011
neural crest cell development disrupted, abnormal zf220Tg + MO1-wnt9a(TU) standard conditions Fig. 5 with image from Curtin et al., 2011
ethmoid cartilage decreased length, abnormal zf393Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal y171Tg; zf169Tg + MO1-wnt9a standard conditions Fig. 3 with image from Grainger et al., 2016
OTHER MO1-wnt9a MORPHOLINO PAGESNo links to external sites
CITATIONS (5)