ZFIN ID: ZDB-MRPHLNO-110304-5
Morpholino Name: MO1-pitpnb
Target: pitpnb (1)
Previous Name: Pitpnb MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACGATATTCCTTGATGAGCACCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pitpnb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pitpnb No data available
PHENOTYPE
Phenotype resulting from MO1-pitpnb
Phenotype Figures
retinal cone cell photoreceptor outer segment decreased amount, abnormal Fig. 6 from Ile et al., 2010
retinal outer nuclear layer disorganized, abnormal Fig. 6 from Ile et al., 2010
retinal pigmented epithelium distance retinal outer nuclear layer, abnormal Fig. 6 from Ile et al., 2010

Phenotype of all Fish created by or utilizing MO1-pitpnb
Phenotype Fish Conditions Figures
retinal pigmented epithelium distance retinal outer nuclear layer, abnormal AB + MO1-pitpnb standard conditions Fig. 6 from Ile et al., 2010
retinal outer nuclear layer disorganized, abnormal AB + MO1-pitpnb standard conditions Fig. 6 from Ile et al., 2010
retinal cone cell photoreceptor outer segment decreased amount, abnormal AB + MO1-pitpnb standard conditions Fig. 6 from Ile et al., 2010
OTHER MO1-pitpnb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)