ZFIN ID: ZDB-MRPHLNO-110304-5
Morpholino Name: MO1-pitpnb
Target: pitpnb (1)
Previous Name: Pitpnb MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACGATATTCCTTGATGAGCACCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pitpnb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pitpnb No data available
PHENOTYPE
Phenotype resulting from MO1-pitpnb
Phenotype of all Fish created by or utilizing MO1-pitpnb
Genome Resources:
CITATIONS (1)