Morpholino

MO1-and2

ID

ZDB-MRPHLNO-100726-5

Name

MO1-and2

Previous Names

None

Target

and2 (1)

Sequence

5' - GCCATTTTTCTCGATTAGCTGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-and2

Expressed Gene	Anatomy	Figures
and1	whole organism	Fig. 3 from Zhang et al., 2010

Phenotype

Phenotype resulting from MO1-and2

No data available

Phenotype of all Fish created by or utilizing MO1-and2

Phenotype	Fish	Conditions	Figures
median fin fold actinotrichium aplastic, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
actinotrichium aplastic, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
regenerating fin actinotrichium disorganized, abnormal	WT + MO1-and1 + MO1-and2	amputation: fin	Fig. 3 from Zhang et al., 2010
median fin fold actinotrichium absent, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
pectoral fin fold decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
cartilage development involved in endochondral bone morphogenesis delayed, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S8 from Zhang et al., 2010
hindbrain deformed, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
scapulocoracoid upper region aplastic, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S8 from Zhang et al., 2010
median fin fold granular, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3, Fig. S6 from Zhang et al., 2010
median fin fold decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3, Fig. S6 from Zhang et al., 2010
pericardium edematous, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
eye decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
cartilage development delayed, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S8 from Zhang et al., 2010
head decreased size, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
actinotrichium absent, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
median fin fold curled, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. 3, Fig. S6 from Zhang et al., 2010
pectoral fin fold absent, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
actinotrichium decreased amount, abnormal	WT + MO1-and1 + MO1-and2	standard conditions	Fig. S6 from Zhang et al., 2010
median fin fold filopodium disoriented, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
pectoral fin fold filopodium absent, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
median fin fold mesenchymal cell disorganized, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010
pectoral fin fold mesenchymal cell absent, abnormal	sqet37Et + MO1-and1 + MO1-and2	standard conditions	Fig. 3 from Zhang et al., 2010

Citations