Morpholino

MO1-tomm22

ID
ZDB-MRPHLNO-100726-1
Name
MO1-tomm22
Previous Names
None
Target
Sequence
5' - GAGAAAGCTCCTGGATCGTAGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tomm22
Phenotype
Phenotype resulting from MO1-tomm22
Phenotype of all Fish created by or utilizing MO1-tomm22
Phenotype Fish Conditions Figures
liver fabp10a expression decreased amount, abnormal WT + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver cell death increased occurrence, abnormal WT + MO1-tomm22 standard conditions Fig. 2 with image from Wu et al., 2017
response to virus process quality, abnormal WT + MO1-tomm22 viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
liver decreased size, abnormal WT + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver decreased size, abnormal as3Tg + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver EGFP expression decreased amount, abnormal as3Tg + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver decreased size, abnormal gz15Tg + MO1-tomm22 standard conditions Fig. 3Fig. 4 from Curado et al., 2010
hepatocyte decreased amount, abnormal gz15Tg + MO1-tomm22 standard conditions Fig. 3 from Curado et al., 2010
cell population proliferation increased occurrence, abnormal gz15Tg + MO1-tomm22 standard conditions Fig. 4 from Curado et al., 2010
hepatocyte ab-2f11 labeling increased amount, abnormal s939Tg + MO1-tomm22 standard conditions Fig. 4 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal s939Tg + MO1-tomm22 standard conditions Fig. 3 with imageFig. 4 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 5 with image from Wu et al., 2017
liver Wnt signaling pathway increased occurrence, abnormal c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
liver d2EGFP expression amount, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 6 with image from Wu et al., 2017
liver Wnt signaling pathway occurrence, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
liver d2EGFP expression increased amount, abnormal c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
liver d2EGFP expression amount, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
liver Wnt signaling pathway occurrence, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 6 with image from Wu et al., 2017
cholangiocyte mAGFP expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
cholangiocyte mAGFP expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
cholangiocyte mCherry expression increased amount, abnormal cz1701Tg; s931Tg; s959Tg + MO1-tomm22 chemical treatment: afimoxifene Fig. 3 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal cz1701Tg; s959Tg + MO1-tomm22 chemical treatment: afimoxifene Fig. 4 with image from Wu et al., 2017
liver d2EGFP expression increased amount, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
liver Wnt signaling pathway increased occurrence, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
cholangiocyte d2EGFP expression increased amount, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
cholangiocyte Wnt signaling pathway increased occurrence, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal pt608Tg; s939Tg + MO1-tomm22 control Fig. 5 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal pt608Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 5 with image from Wu et al., 2017
hepatocyte cell population proliferation decreased occurrence, abnormal pt608Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 5 with image from Wu et al., 2017
liver cell death increased occurrence, abnormal s931Tg; s939Tg + MO1-tomm22 standard conditions Fig. 2 with image from Wu et al., 2017
liver macrophage increased amount, abnormal s931Tg; s939Tg; uwm12Tg + MO1-tomm22 standard conditions Fig. 6 with image from Wu et al., 2017
liver macrophage shape, abnormal s931Tg; s939Tg; uwm12Tg + MO1-tomm22 standard conditions Fig. 6 with image from Wu et al., 2017
liver macrophage increased amount, abnormal s931Tg; uwm12Tg + MO1-tomm22 standard conditions Fig. 6 with image from Wu et al., 2017
liver decreased size, abnormal wnt2bbs403/s403 + MO1-tomm22 standard conditions Fig. 4 from Curado et al., 2010
Citations