Morpholino

MO5-sdc2

ID
ZDB-MRPHLNO-100513-2
Name
MO5-sdc2
Previous Names
  • MO(AUG) (1)
Target
Sequence
5' - ATCCAAAGGTTCCTCATAATTCCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-sdc2
Expressed Gene Anatomy Figures
dand5 Fig. 2 with image from Arrington et al., 2013
fgf2 Fig. 4 with image from Arrington et al., 2013
foxa3 Fig. 2 with image from Arrington et al., 2009
myl7 Fig. 2 with image from Arrington et al., 2009
sox17 Fig. 2 with image from Arrington et al., 2013
tbx16 Fig. 5 with image from Arrington et al., 2013
Phenotype
Phenotype resulting from MO5-sdc2
Phenotype Fish Figures
apical protein localization disrupted, abnormal twu34Tg + MO5-sdc2 Fig. 3 with image from Arrington et al., 2009
basement membrane organization disrupted, abnormal twu34Tg + MO5-sdc2 Fig. 3 with image from Arrington et al., 2009
cell migration involved in heart development disrupted, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO5-sdc2 Fig. 1 with image from Arrington et al., 2013
digestive tract development disrupted, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal AB + MO5-sdc2 Fig. 3 with image from Arrington et al., 2013
extension morphology, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
forerunner cell group decreased size, abnormal s870Tg + MO5-sdc2 Fig. 2 with image from Arrington et al., 2013
forerunner cell group physical object quality, abnormal AB + MO5-sdc2 Fig. 5 with image from Arrington et al., 2013
heart symmetry, abnormal AB + MO5-sdc2 Fig. 1 with image from Arrington et al., 2013
heart development disrupted, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
heart looping process quality, abnormal AB + MO5-sdc2 Fig. 1 with image from Arrington et al., 2013
Kupffer's vesicle decreased size, abnormal AB + MO5-sdc2 Fig. 2 with image,  Fig. 6 with image from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal s870Tg + MO5-sdc2 Fig. 2 with image,  Fig. 6 with image from Arrington et al., 2013
Kupffer's vesicle physical object quality, abnormal AB + MO5-sdc2 Fig. 4 with image from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased amount, abnormal AB + MO5-sdc2 Fig. 3 with image,  Fig. 6 with image from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO5-sdc2 Fig. 3 with image,  Fig. 6 with image from Arrington et al., 2013
Kupffer's vesicle development process quality, abnormal AB + MO5-sdc2 Fig. 2 with image,  Fig. 4 with image,  Fig. 6 with image from Arrington et al., 2013
lateral plate mesoderm symmetry, abnormal AB + MO5-sdc2 Fig. 1 with image from Arrington et al., 2013
pericardium edematous, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
pigmentation decreased occurrence, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
regulation of fibroblast growth factor receptor signaling pathway process quality, abnormal AB + MO5-sdc2 Fig. 4 with image from Arrington et al., 2013
supramolecular fiber organization disrupted, abnormal AB + MO5-sdc2 Fig. 4 with image from Arrington et al., 2009
whole organism decreased size, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
yolk increased size, abnormal AB + MO5-sdc2 Fig. 2 with image from Arrington et al., 2009
Phenotype of all Fish created by or utilizing MO5-sdc2
Phenotype Fish Conditions Figures
heart symmetry, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
extension morphology, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
pericardium edematous, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with image,  Fig. 6 with image from Arrington et al., 2013
lateral plate mesoderm symmetry, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
pigmentation decreased occurrence, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
heart development disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
Kupffer's vesicle motile cilium decreased amount, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with image,  Fig. 6 with image from Arrington et al., 2013
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2013
Kupffer's vesicle physical object quality, abnormal AB + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2013
digestive tract development disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
cell migration involved in heart development disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
supramolecular fiber organization disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO5-sdc2 chemical treatment: messenger RNA Fig. 6 with image from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image,  Fig. 6 with image from Arrington et al., 2013
whole organism decreased size, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
Kupffer's vesicle decreased size, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image,  Fig. 6 with image from Arrington et al., 2013
heart looping process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
basement membrane organization disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2009
yolk increased size, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
Kupffer's vesicle development process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 6 with image from Arrington et al., 2013
forerunner cell group physical object quality, abnormal AB + MO5-sdc2 standard conditions Fig. 5 with image from Arrington et al., 2013
regulation of fibroblast growth factor receptor signaling pathway process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2013
Kupffer's vesicle development process quality, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
Kupffer's vesicle decreased size, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
forerunner cell group decreased size, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
apical protein localization disrupted, abnormal twu34Tg + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2009
basement membrane organization disrupted, abnormal twu34Tg + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO1-fgf2 + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2013
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO3-tbx16 + MO5-sdc2 standard conditions Fig. 5 with image from Arrington et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.