header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100426-6
Morpholino Name: MO4-fsta
Target: fsta (1)
Sequence:
5' - CGTCTCTGAAATTCACATGGTTTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocker.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-fsta No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-fsta No data available
PHENOTYPE
Phenotype resulting from MO4-fsta
Phenotype of all Fish created by or utilizing MO4-fsta
OTHER MO4-fsta MORPHOLINO PAGESNo links to external sites
CITATIONS (1)