header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100416-5
Morpholino Name: MO1-adrb2a
Target: adrb2a (1)
Sequence:
5' - GTATTGAGGACCTTATGTTTCCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-adrb2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-adrb2a
Expressed Gene Anatomy Figures
atp5f1b Fig. 5 with image from Wang et al., 2009
atp5fa1 text only from Wang et al., 2009
atp7a text only from Wang et al., 2009
dct text only from Wang et al., 2009
ddc text only from Wang et al., 2009
kitlga text only from Wang et al., 2009
mitfa text only from Wang et al., 2009
prkcbb text only from Wang et al., 2009
rack1 text only from Wang et al., 2009
slc24a5 text only from Wang et al., 2009
tgfb1a text only from Wang et al., 2009
tnfa text only from Wang et al., 2009
tyr Fig. 5 with image from Wang et al., 2009
tyrp1b text only from Wang et al., 2009
PHENOTYPE
Phenotype resulting from MO1-adrb2a
Phenotype of all Fish created by or utilizing MO1-adrb2a
OTHER MO1-adrb2a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)