header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-091117-1
Morpholino Name: MO1-duox
Target: duox (1)
Previous Name: MO1-duox1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGTGAATTAGAGAAATGCACCTTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-duox No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-duox No data available
PHENOTYPE
Phenotype resulting from MO1-duox
Phenotype of all Fish created by or utilizing MO1-duox
Phenotype Fish Conditions Figures
cell death increased occurrence, abnormal AB + MO1-duox standard conditions text only from Niethammer et al., 2009
response to wounding disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
leukocyte migration disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
hydrogen peroxide biosynthetic process disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
neutrophil phagocytosis decreased process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with image from Brothers et al., 2013
neutrophil chemotaxis process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with image from Brothers et al., 2013
defense response to fungus process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Brothers et al., 2013
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 2 from de Oliveira et al., 2014
neutrophil chemotaxis decreased process quality, abnormal nz50Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 2 from de Oliveira et al., 2014
peptidyl-tyrosine autophosphorylation decreased occurrence, abnormal uwm5Tg + MO1-duox + MO4-tp53 physical alteration: anatomical structure Fig. 1 from Yoo et al., 2011
macrophage response to wounding process quality, abnormal uwm12Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 3 from Tauzin et al., 2014
macrophage chemotaxis process quality, abnormal uwm12Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 3 from Tauzin et al., 2014
regenerating fin caudal fin EGFP expression decreased amount, abnormal uwm37Tg + MO1-duox + MO4-tp53(AB) resection: caudal fin Fig. 2 S1 with image from LeBert et al., 2018
OTHER MO1-duox MORPHOLINO PAGESNo links to external sites
CITATIONS (14)