header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090511-1
Morpholino Name: MO1-rhcgb
Target: rhcgb (1)
Previous Names: MO1-rhcgl2, rhcg1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAGTTGCCCATGTCTACAGCTTGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rhcgb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rhcgb
Expressed Gene Anatomy Figures
rhbg Fig. 5 from Shih et al., 2013
rhcgb Fig. 5 from Shih et al., 2013
Fig. 8 from Shih et al., 2008
PHENOTYPE
Phenotype resulting from MO1-rhcgb
Phenotype of all Fish created by or utilizing MO1-rhcgb
OTHER MO1-rhcgb MORPHOLINO PAGES No links to external sites
CITATIONS (3)