header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090206-6
Morpholino Name: MO2-gpr161
Target: gpr161 (1)
Previous Name: MO#36 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGGCTTCTGGTTGCCAATGACTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targeting at 5' UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gpr161 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gpr161
Expressed Gene Anatomy Figures
myl7 Fig. 2 with imageFig. S3 with image from Leung et al., 2008
PHENOTYPE
Phenotype resulting from MO2-gpr161
Phenotype of all Fish created by or utilizing MO2-gpr161
OTHER MO2-gpr161 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)