Morpholino

MO1-itga7

ID

ZDB-MRPHLNO-080930-1

Name

MO1-itga7

Previous Names

integrin a7-ATG MO (1)

Target

itga7 (1)

Sequence

5' - GACCCACAGAGACATGACCAGCTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-itga7

Expressed Gene	Anatomy	Figures
pxna	somite border muscle tendon junction	Fig. 4 from Postel et al., 2008

Phenotype

Phenotype resulting from MO1-itga7

Phenotype	Fish	Figures
myotome dystrophic, abnormal	AB/TU + MO1-itga7	Fig. 2 from Charvet et al., 2013
skeletal muscle cell actin cytoskeleton retracted, abnormal	WT + MO1-itga7	Fig. 3 from Postel et al., 2008
skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO1-itga7	Fig. 2 from Charvet et al., 2013
somite morphology, abnormal	WT + MO1-itga7	Fig. 4 from Postel et al., 2008
somite border U-shaped, abnormal	WT + MO1-itga7	Fig. 4 from Postel et al., 2008
whole organism paralysed, abnormal	WT + MO1-itga7	Fig. 3 from Postel et al., 2008

Phenotype of all Fish created by or utilizing MO1-itga7

Phenotype	Fish	Conditions	Figures
skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO1-itga7	standard conditions	Fig. 2 from Charvet et al., 2013
myotome dystrophic, abnormal	AB/TU + MO1-itga7	standard conditions	Fig. 2 from Charvet et al., 2013
somite morphology, abnormal	WT + MO1-itga7	standard conditions	Fig. 4 from Postel et al., 2008
somite border U-shaped, abnormal	WT + MO1-itga7	standard conditions	Fig. 4 from Postel et al., 2008
skeletal muscle cell actin cytoskeleton retracted, abnormal	WT + MO1-itga7	standard conditions	Fig. 3 from Postel et al., 2008
whole organism paralysed, abnormal	WT + MO1-itga7	standard conditions	Fig. 3 from Postel et al., 2008
muscle attachment decreased process quality, abnormal	AB/TU + MO1-itga7 + MO1-lama2	standard conditions	Fig. 6 from Charvet et al., 2013
skeletal muscle cell detached from vertical myoseptum, abnormal	AB/TU + MO1-itga7 + MO1-lama2	standard conditions	Fig. 6 from Charvet et al., 2013
muscle attachment decreased process quality, abnormal	AB/TU + MO1-itga7 + MO2-col22a1	standard conditions	Fig. 6 from Charvet et al., 2013
skeletal muscle cell detached from vertical myoseptum, abnormal	AB/TU + MO1-itga7 + MO2-col22a1	standard conditions	Fig. 6 from Charvet et al., 2013
muscle attachment disrupted, abnormal	vu119Tg + MO1-itga7	standard conditions	Fig. 5 from Postel et al., 2008
skeletal muscle cell actin cytoskeleton retracted, abnormal	vu119Tg + MO1-itga7	standard conditions	Fig. 5 from Postel et al., 2008
skeletal muscle cell sarcolemma retracted, abnormal	vu119Tg + MO1-itga7	standard conditions	Fig. 5 from Postel et al., 2008

Citations