header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080325-3
Morpholino Name: MO2-epor
Target: epor (1)
Sequence:
5' - TATGCGATTGACTTACATGTATGTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino could not be confirmed to hit epor on Zv7. It does hit in the region suggesting an assembly error.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-epor No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-epor No data available
PHENOTYPE
Phenotype resulting from MO2-epor
No data available

Phenotype of all Fish created by or utilizing MO2-epor
OTHER MO2-epor MORPHOLINO PAGES No links to external sites
CITATIONS (1)